Screening of HIV-1 integrase CTD and NTD co-binding candidate peptide drugs

doi:10.3877/cma.j.issn.2095-1221.2022.05.001

Abstract

Abstract:

Objective

To screen human immunodeficiency virus 1 (HIV-1) integrase (IN) C-terminal domain (CTD) and N-terminal domain (NTD) peptide drugs using bimolecular fluorescence complementation (BiFC) technology.

Methods

The recombinant plasmids pBiFc-VN173-Flag-IN-CTD and pBiFc-VN173-Flag-IN-NTD of HIV-1 integrase CTD and NTD were constructed for the screening of HIV-1 integrase by BiFC technology and identified by restriction endonuclease enzyme and sequencing. The recombinant plasmids (pBiFc-VN173-Flag-IN-CTD and pBiFc-VN173-Flag-IN-NTD) and the control plasmid pBiFC-VN173-Flag were transfected into HEK293T cells, respectively, and the expression levels of fused proteins were identified by Western blotting with anti-Flag antibody. The two recombinant plasmids and the control plasmid were co-transfected into HEK293T cells with the peptide library pBiFc-VC155-TrxA-11AA-TrxA, respectively, then the intensity of green fluorescence was observed under a fluorescence microscope. The selected polypeptide expression vector pcDNA3.1-cmyc-11AA and the control vector pcDNA3.1-cmyc were transfected into HEK293T cells, then after 24 hours the cells were infected with lentivirus expressing green fluorescence protein, and the green fluorescence intensity was observed 36 hours later.

Results

The recombinant plasmids pBiFc-VN173-Flag-IN-CTD and pBiFc-VN173-Flag-IN-NTD were confirmed by restriction endonuclease enzyme digestion and sequencing, and the fused proteins expressed by these two plasmids could be detected with anti-Flag antibody. In addition, peptide 4 and peptide 192 were screened from the peptide library after co-transfection with recombinant plasmids in HEK293T cells based on the occurrence of green fluorescence. After lentivirus infection, the fluorescence intensity of HEK293T cells transfected with peptide expression vectors pcDNA3.1-cmyc-peptide 4 and pcDNA3.1-cmyc-peptide 192 was significantly decreased compared with the control.

Conclusions

Two plasmids expressing Flag-fused HIV-1 integrase CTD and NTD were successfully constructed and confirmed. Two peptides including peptide 4 and peptide 192 could target these two specific domains within HIV-1 integrase, were obtained based on BiFC technology. They maybe inhibit lentiviral integration though binding to integrase.

Key words: HIV-1 integrase, NTD, CTD, Peptide drugs, Bimolecular fluorescence complementation technology

Liying Ye, Zhenfei Peng. Screening of HIV-1 integrase CTD and NTD co-binding candidate peptide drugs[J]. Chinese Journal of Cell and Stem Cell(Electronic Edition), 2022, 12(05): 257-265.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhxbygxbzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.2095-1221.2022.05.001

https://zhxbygxbzz.cma-cmc.com.cn/EN/Y2022/V12/I05/257

Figures/Tables 11

References 44

1	Barre-Sinoussi F, Chermann JC, Rey F, et al. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS)[J]. Science, 1983, 220(4599):868-871.
2	Hu WS, Hughes SH. HIV-1 reverse transcription[J]. Cold Spring Harb Perspect Med, 2012, 2(10):a006882. doi: 10.1101/cshperspect.a006882.
3	Engelman A, Mizuuchi K, Craigie R. HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer[J]. Cell, 1991, 67(6):1211-1221.
4	Brown PO, Bowerman B, Varmus HE, et al. Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein[J]. Proc Natl Acad Sci U S A, 1989, 86(8):2525-2529.
5	Krishnan L, Li X, Naraharisetty HL, et al. Structure-based modeling of the functional HIV-1 intasome and its inhibition[J]. Proc Natl Acad Sci U S A, 2010, 107(36):15910-15915.
6	Hare S, Gupta SS, Valkov E, et al. Retroviral intasome assembly and inhibition of DNA strand transfer[J]. Nature, 2010, 464(7286):232-236.
7	Maertens G, Cherepanov P, Pluymers W, et al. LEDGF/p75 is essential for nuclear and chromosomal targeting of HIV-1 integrase in human cells[J]. J Biol Chem, 2003, 278(35):33528-33539.
8	Ciuffi A, Llano M, Poeschla E, et al. A role for LEDGF/p75 in targeting HIV DNA integration[J]. Nat Med, 2005, 11(12):1287-1289.
9	Lapaillerie D, Lelandais B, Mauro E, et al. Modulation of the intrinsic chromatin binding property of HIV-1 integrase by LEDGF/p75[J]. Nucleic Acids Res, 2021, 49(19):11241-11256.
10	Kessl JJ, Kutluay SB, Townsend D, et al. HIV-1 integrase binds the viral RNA genome and is essential during virion morphogenesis[J]. Cell, 2016, 166(5):1257-1268.e1212.
11	Elliott JL, Eschbach JE, Koneru PC, et al. Integrase-RNA interactions underscore the critical role of integrase in HIV-1 virion morphogenesis[J]. Elife, 2020, 9:e54311. doi: 10.7554/eLife.54311.
12	Elliott JL, Kutluay SB. Going beyond integration: the emerging role of HIV-1 integrase in virion morphogenesis[J]. Viruses, 2020, 12(9):1005. doi: 10.3390/v12091005.
13	Summa V, Petrocchi A, Bonelli F, et al. Discovery of raltegravir, a potent, selective orally bioavailable HIV-integrase inhibitor for the treatment of HIV-AIDS infection[J]. J Med Chem, 2008, 51(18):5843-5855.
14	Pommier Y, Johnson AA, Marchand C. Integrase inhibitors to treat HIV/AIDS[J]. Nat Rev Drug Discov, 2005, 4(3):236-248.
15	Johnson AA, Marchand C, Pommier Y. HIV-1 integrase inhibitors: a decade of research and two drugs in clinical trial[J]. Curr Top Med Chem, 2004, 4(10):1059-1077.
16	Wang Y, Gu S X, He Q, et al. Advances in the development of HIV integrase strand transfer inhibitors[J]. Eur J Med Chem, 2021, 225:113787. doi: 10.1016/j.ejmech.2021.113787.
17	Smith SJ, Zhao XZ, Passos DO, et al. Integrase strand transfer inhibitors are effective Anti-HIV drugs[J]. Viruses, 2021, 13(2):205. doi: 10.3390/v13020205.
18	Mbhele N, Chimukangara B, Gordon M. HIV-1 integrase strand transfer inhibitors: a review of current drugs, recent advances and drug resistance[J]. Int J Antimicrob Agents, 2021, 57(5):106343. doi: 10.1016/j.ijantimicag.2021.106343.
19	Karimi N, Roudsari RV, Hajimahdi Z, et al. Design, synthesis, and docking studies of thioimidazolyl diketoacid derivatives targeting HIV- 1 integrase[J]. Med Chem, 2022, 18(5):616-628.
20	Adu-Ampratwum D, Pan Y, Koneru PC, et al. Identification and optimization of a Novel HIV-1 integrase inhibitor[J]. ACS Omega, 2022, 7(5):4482-4491.
21	Parvez MK, Al-Dosari MS, Sinha GP. Machine learning-based predictive models for identifying high active compounds against HIV-1 integrase[J]. SAR QSAR Environ Res, 2022, 33(5):387-402.
22	Zhang C, Xie Q, Wan CC, et al. Recent advances in small-molecule HIV-1 integrase inhibitors[J]. Curr Med Chem, 2021, 28(24):4910-4934.
23	Ohata Y, Tomonaga M, Watanabe Y, et al. Antiviral activity and resistance profile of the novel HIV-1 non-catalytic site integrase inhibitor JTP-0157602[J]. J Virol, 2022, 96(6):e0184321.doi: 10.1128/JVI.01843-21.
24	Taoda Y, Akiyama T, Tomita K, et al. Discovery of tricyclic HIV-1 integrase-LEDGF/p75 allosteric inhibitors by intramolecular direct arylation reaction[J]. Bioorg Med Chem Lett, 2022, 64:128664. doi: 10.1016/j.bmcl.2022.128664.
25	Sugiyama S, Akiyama T, Taoda Y, et al. Discovery of novel HIV-1 integrase-LEDGF/p75 allosteric inhibitors based on a pyridine scaffold forming an intramolecular hydrogen bond[J]. Bioorg Med Chem Lett, 2021, 33:127742. doi: 10.1016/j.bmcl.2020.127742.
26	Debyser Z, Bruggemans A, Van Belle S, et al. LEDGINs, inhibitors of the interaction between HIV-1 integrase and LEDGF/p75, are potent antivirals with a potential to cure HIV infection[J]. Adv Exp Med Biol, 2021, 1322:97-114.
27	Maehigashi T, Ahn S, Kim UI, et al. A highly potent and safe pyrrolopyridine-based allosteric HIV-1 integrase inhibitor targeting host LEDGF/p75-integrase interaction site[J]. PLoS Pathog, 2021, 17(7):e1009671.doi: 10.1371/journal.ppat.1009671.
28	Rashamuse TJ, Fish MQ, Coyanis EM, et al. Studies towards the design and synthesis of novel 1,5-Diaryl-1H-imidazole-4-carboxylic acids and 1,5-Diaryl-1H-imidazole-4-carbohydrazides as host LEDGF/p75 and HIV-1 integrase interaction inhibitors[J]. Molecules, 2021, 26(20):6203. doi: 10.3390/molecules26206203.
29	Panwar U, Singh SK. In silico virtual screening of potent inhibitor to hamper the interaction between HIV-1 integrase and LEDGF/p75 interaction using E-pharmacophore modeling, molecular docking, and dynamics simulations[J]. Comput Biol Chem, 2021, 93:107509. doi: 10.1016/j.compbiolchem.2021.107509.
30	Kessl JJ, Jena N, Koh Y, et al. Multimode, cooperative mechanism of action of allosteric HIV-1 integrase inhibitors[J]. J Biol Chem, 2012, 287(20):16801-16811.
31	Tsiang M, Jones GS, Niedziela-Majka A, et al. New class of HIV-1 integrase (IN) inhibitors with a dual mode of action[J]. J Biol Chem, 2012, 287(25):21189-21203.
32	Balakrishnan M, Yant SR, Tsai L, et al. Non-catalytic site HIV-1 integrase inhibitors disrupt core maturation and induce a reverse transcription block in target cells[J]. PLoS One, 2013, 8(9):e74163. doi: 10.1371/journal.pone.0074163.
33	Jurado KA, Wang H, Slaughter A, et al. Allosteric integrase inhibitor potency is determined through the inhibition of HIV-1 particle maturation[J]. Proc Natl Acad Sci U S A, 2013, 110(21):8690-8695.
34	Eijkelenboom AP, van den Ent FM, Vos A, et al. The solution structure of the amino-terminal HHCC domain of HIV-2 integrase: a three-helix bundle stabilized by zinc[J]. Curr Biol, 1997, 7(10):739-746.
35	Goldgur Y, Dyda F, Hickman AB, et al. Three new structures of the core domain of HIV-1 integrase: an active site that binds magnesium[J]. Proc Natl Acad Sci U S A, 1998, 95(16):9150-9154.
36	Sangeetha B, Muthukumaran R, Amutha R. The dynamics of interconverting D- and E-forms of the HIV-1 integrase N-terminal domain[J]. Eur Biophys J, 2014, 43(10-11):485-498.
37	Zheng R, Jenkins TM, Craigie R. Zinc folds the N-terminal domain of HIV-1 integrase, promotes multimerization, and enhances catalytic activity[J]. Proc Natl Acad Sci U S A, 1996, 93(24):13659-13664.
38	Cherepanov P, Ambrosio AL, Rahman S, et al. Structural basis for the recognition between HIV-1 integrase and transcriptional coactivator p75[J]. Proc Natl Acad Sci U S A, 2005, 102(48):17308-17313.
39	Hare S, Shun MC, Gupta SS, et al. A novel co-crystal structure affords the design of gain-of-function lentiviral integrase mutants in the presence of modified PSIP1/LEDGF/p75[J]. PLoS Pathog, 2009, 5(1):e1000259. doi: 10.1371/journal.ppat.1000259.
40	Knyazhanskaya E, Anisenko A, Shadrina O, et al. NHEJ pathway is involved in post-integrational DNA repair due to Ku70 binding to HIV-1 integrase[J]. Retrovirology, 2019, 16(1):30. doi: 10.1186/s12977-019-0492-z.
41	Cereseto A, Manganaro L, Gutierrez MI, et al. Acetylation of HIV-1 integrase by p300 regulates viral integration[J]. EMBO J, 2005, 24(17):3070-3081.
42	Terreni M, Valentini P, Liverani V, et al. GCN5-dependent acetylation of HIV-1 integrase enhances viral integration[J]. Retrovirology, 2010, 7:18. doi: 10.1186/1742-4690-7-18.
43	Winans S, Goff S P. Mutations altering acetylated residues in the CTD of HIV-1 integrase cause defects in proviral transcription at early times after integration of viral DNA[J]. PLoS Pathog, 2020, 16(12):e1009147. doi: 10.1371/journal.ppat.1009147.
44	Schneider W M, Wu DT, Amin V, et al. MuLV IN mutants responsive to HDAC inhibitors enhance transcription from unintegrated retroviral DNA[J]. Virology, 2012, 426(2):188-196.

基因	序列（5'→3'）	预期产物扩增长度（bp）
IN-NTD	上游CGGAATTCATTTTTAGATGGAATAGAT	150
	下游GGGGTACCGACATGGCTTCCCCTTTTAG
IN-CTD	上游CGGAATTCATTACAAAAACAAATTACA	228
	下游GGGGTACCGAATCCTCATCCTGTCTACT

基因	序列（5'→3'）	预期产物扩增长度（bp）
IN-NTD	上游CGGAATTCATTTTTAGATGGAATAGAT	150
	下游GGGGTACCGACATGGCTTCCCCTTTTAG
IN-CTD	上游CGGAATTCATTACAAAAACAAATTACA	228
	下游GGGGTACCGAATCCTCATCCTGTCTACT

Peptide序号	核苷酸序列	氨基酸序列
12	TTTTTTTTCATTCTCCAGTTTGTCTCTACCTTG	FFFILQFVSTL
15	TGTTGTTTAGTATTTTTTTTGTTTCTATTTTTG	CCLVFFLFLFL
4	GTTGTTGCATTTGAATTTGGCTTTGTATTTCTG	VVAFEFGFVFL
192	TTTTCTGTGTCTTTTTTTTCTTATTGGTTTCTG	FSVSFFSYWFL

Peptide序号	核苷酸序列	氨基酸序列
12	TTTTTTTTCATTCTCCAGTTTGTCTCTACCTTG	FFFILQFVSTL
15	TGTTGTTTAGTATTTTTTTTGTTTCTATTTTTG	CCLVFFLFLFL
4	GTTGTTGCATTTGAATTTGGCTTTGTATTTCTG	VVAFEFGFVFL
192	TTTTCTGTGTCTTTTTTTTCTTATTGGTTTCTG	FSVSFFSYWFL

[1]	Qian Liu, Wei Cui, Yibo Gao, Zeyue Zhang, Diange Li, Zhijie Wang, Jie Wang, Jie He, Expert Group of China Guideline for the Screening and Early Diagnosis and Treatment of Colorectal Cancer. New screening strategies for early colorectal tumors: a screening protocol based on liquid biopsy techniques [J]. Chinese Journal of Colorectal Diseases(Electronic Edition), 2023, 12(01): 17-20.
[2]	Baocai Xing, Wei Liu. The advances of the liquid biopsy in colorectal cancer [J]. Chinese Journal of Colorectal Diseases(Electronic Edition), 2016, 05(02): 110-113.
[3]	Yunjian Xu, Jianping Wang, Yongping Lin, Juhong Jiang. Feasibility and application of small volume nucleic acid sample to detect the EGFR mutation in peripheral blood from patients with advanced non-small cell lung cancer [J]. Chinese Journal of Clinical Laboratory Management(Electronic Edition), 2021, 09(03): 164-168.

Please choose a citation manager

Content to export