Dural regulation of CHOP on apoptosis and autophagy on DU-145 cells induced by tunicamycin

doi:10.3877/cma.j.issn.2095-1221.2018.05.001

Abstract

Abstract:

Objective

To explore the role and mechanism of endoplasmic reticulum stress key molecule CHOP in regulating apoptosis and autophagy.

Methods

Endoplasmic reticulum stress was induced by tunicamycin in DU-145 cells. We detected the expression of endoplasmic reticulum stress-related proteins Grp78, Grp94, p-eIF2α, CHOP and autophagic proteins LC3Ⅱ, Atg5 and Beclin1 by Western Blot, and then we analysed the level of apotosis by flow cytometry. We detected the expression of PARP and Caspase3 by Western Blot and the rate of apotosis by flow cytometry after silencing of CHOP. The expression of autophagic marker LC3B was detected by immunofluorescence assay after silencing of CHOP.

Results

Tunicamycin could slightly induce apotosis, the apoptotic rate of DU-145 cells treated with tunicamycin for 8, 12 and 24?h were 3.27﹪?±?1.02﹪, 8.97﹪?±?0.71﹪ and 11.67﹪±1.41﹪ reepectively. The apoptotic rates at 12?h and 24?h were higher than the control group (P < 0.01). Tunicamycin could active autophagy in DU-145 cells under endoplasmic reticulum stress through inhibiting PI3K/AKt/mTOR pathway. CHOP gene silencing could inhibit apotosis and promote the expression of LC3B significantly. The apoptosis rates of the shCtrl group and shCHOP group were 32.17﹪±3.93﹪ and 23.53﹪±3.41﹪, respectively. There was statistical significance between the two groups (P < 0.05).

Conclusions

CHOP palys a dural regulatory role between apoptosis and autophagy in DU-145 cells under endoplasmic reticulum stress induced by tunicamycin.

Key words: Endoplasmic reticulum stress, Autophagy, Apotosis, DU-145 cells, Tunicamycin

Yan Lei, Shihuai Zhan, Junqiu Chen, Huiyue Dong, Rong Lin, Jin Chen, Shuiliang Wang, Lianghu Huang. Dural regulation of CHOP on apoptosis and autophagy on DU-145 cells induced by tunicamycin[J]. Chinese Journal of Cell and Stem Cell(Electronic Edition), 2018, 08(05): 257-263.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhxbygxbzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.2095-1221.2018.05.001

https://zhxbygxbzz.cma-cmc.com.cn/EN/Y2018/V08/I05/257

Figures/Tables 8

References 14

1	Lee WS, Yoo WH, Chae HJ. ER stress and autophagy[J]. Curr Mol Med, 2015, 15(8):735-745.
2	Avivar-Valderas A, Salas E, Bobronvnikova-Marjon E, et al. PERK integrates autophagy and oxidative stress response topromote survival during extracellular matrix detachment[J]. Mol Cell Biol, 2011, 31(17): 3616-3629.
3	Kouroku Y, Fujita E, Tanida I, et al. ER stress (PERK/eIF2alpha phosphorylation) mediates the polyglutamine-induced LC3 conversion, an essential step for autophagy formation[J]. Cell Death Differ, 2007, 14(2):230-239.
4	Song S, Tan J, Miao Y, et al. Crosstalk of autophagy and apoptosis: Involvement of the dual role of autophagy under ER stress[J]. J Cell Physiol, 2017, 232(11):2977-2984.
5	Kaneko M, Imaizumi K, Saito A, et al. ER stress and disease: toward prevention and treatment[J]. Biol Pharm Bull, 2017, 40(9):1337-1343.
6	Li Y, Guo Y, Tang J, et al. New insights into the roles of CHOP-induced apotosis in ERstress[J]. ActaBiochimBiophys Sin, 2014, 46(8):629-640.
7	Guo XQ, Meng Y, Sheng XT, et al. Tunicamycin enchances human colon cancer cells to TRALL-induced apotosis by JNK-CHOP mediated Dr5 upregulation and the inhibition of EGFR Pathway[J]. Anticancer Durgs, 2017, 28(1):66-74.
8	雷艳, 任冰霜, 詹世淮, 等. 沉默CHOP基因降低衣霉素诱导的小鼠肝癌Hepa 1-6细胞凋亡[J]. 基础医学与临床, 2016, 36(12):1646-1654.
9	Han B, Yu YQ, Yang QL, et al. Kaempferol induces hepatocellular carcinoma cell death via endoplasmic reticulum stress-CHOP-autophagy signaling pathway[J]. Oncotarget, 2017, 8(47):82207-82216.
10	Matsumoto H, Miyazaki S, Matsuyama SA, et al. Selection of autophagy or apoptosis in cells exposed to ER-stress depends on ATF4 expression pattern with or without CHOP expression[J]. Biol Open, 2013, 2(10):1084-1090.
11	B'chir W, Chaveroux C, Carraro V, et al. Dual role for CHOP in the crosstalk between autophagy and apoptosis to determine cell fate in response to amino acid deprivation[J]. Cell Signal, 2014, 26(7):1385-1391.
12	Tang ZH, Chen X, Wang ZY, et al. Induction of C/EBP homologous protein-mediated apoptosis and autophagy by licochalcone A in non-small cell lung cancer cells[J]. Sci Rep, 2016, 6:26241.
13	Shin YJ, Han SH, Kim DS, et al. Autophagy induction and CHOP under-expression promotes survival of fibroblasts from rheumatoid arthritis patients under endoplasmic reticulum stress[J]. Arthritis Res Ther, 2010, 12(1):R19.
14	Lei Y, Wang SL, Ren BS, et al. CHOP favors endoplasmic reticulum stressinduced apoptosis in hepatocellular carcinoma cells via inhibition of autophagy[J]. PLoS One, 2017, 12(8):e0183680.

Group	Sense（5'→3'）	Anti-sense（5'→3'）
shCHOP-1	CCGGGAAACGAAGAGGAA	AATTCAAAAAGAAACGAA
?	GAATCAACTCGAGTTGATT	GAGGAAGAATCAACTCGA
?	CTTCCTCTTCGTTTCTTTTTG	GTTGATTCTTCCTCTTCGTTT
shCHOP-2	CCGGTGAAGAGAACGAGC	AATTCAAAAATGAATGAGAA
?	GGCTCAACTCGAGTTGAGC	CGAGCGGCTCAACTCGAGTT
?	CGCTCGTTCTCATTCATTTTTG	GAGCCGCTCGTTCTCTTCA
LC3BshRNA	CCGGGCTCAATGCTAACCA	AATTCAAAAAGCTCAATGC
?	AGCCTTCTCGAGAAGGCTT	TAACCAAGCCTTCTCGAGA
?	GGTTAGCATTGAGCTTTTTG	AGGCTTGGTTAGCATTGAGC

Group	Sense（5'→3'）	Anti-sense（5'→3'）
shCHOP-1	CCGGGAAACGAAGAGGAA	AATTCAAAAAGAAACGAA
?	GAATCAACTCGAGTTGATT	GAGGAAGAATCAACTCGA
?	CTTCCTCTTCGTTTCTTTTTG	GTTGATTCTTCCTCTTCGTTT
shCHOP-2	CCGGTGAAGAGAACGAGC	AATTCAAAAATGAATGAGAA
?	GGCTCAACTCGAGTTGAGC	CGAGCGGCTCAACTCGAGTT
?	CGCTCGTTCTCATTCATTTTTG	GAGCCGCTCGTTCTCTTCA
LC3BshRNA	CCGGGCTCAATGCTAACCA	AATTCAAAAAGCTCAATGC
?	AGCCTTCTCGAGAAGGCTT	TAACCAAGCCTTCTCGAGA
?	GGTTAGCATTGAGCTTTTTG	AGGCTTGGTTAGCATTGAGC

[1]	Kang Li, Liang Ji, Wei Zhao, Lemin Lin. Dual role of autophagy in biological progression of breast cancer [J]. Chinese Journal of Breast Disease(Electronic Edition), 2023, 17(04): 195-202.
[2]	Yingying Kong, Lutao Xie, Xiaochi Lu, Jiefeng Xu, Guangju Zhou, Mao Zhang. Protective effect and mechanism of sodium butyrate on cardio-brain injury after cardiac arrest resuscitation in pigs [J]. Chinese Journal of Critical Care Medicine(Electronic Edition), 2023, 16(05): 355-362.
[3]	Ling Chen, Nan Li, Jianle Yang. Mechanism of microRNA-377-3p regulating autophagy to ameliorate lipopolysaccharide / D-galactosamine-induced acute liver failure [J]. Chinese Journal of Critical Care Medicine(Electronic Edition), 2023, 16(02): 89-97.
[4]	Zihui Zhou, Gongchi Li, Binghui Li, Zhi Wang, Huizhen Liu, Hui Wang, Lijun Zou. Advances of autophagy in wound healing [J]. Chinese Journal of Injury Repair and Wound Healing(Electronic Edition), 2023, 18(06): 542-546.
[5]	Changwen Zhang, Shaoqing Lin, Minjie Lv, Xiao Jin, Changjun Zhu, Ganzhu Feng. Inhibition of autophagy of macrophages by secreted protein Pec1 of Pseudomonas aeruginosa and its effect on clearance of Pseudomonas aeruginosa [J]. Chinese Journal of Experimental and Clinical Infectious Diseases(Electronic Edition), 2022, 16(06): 370-376.
[6]	Wentao Zhong, Yang Zhao, Xiaofei Shen, Junfeng Du. The role of autophagy in sepsis and progress in targeted therapy [J]. Chinese Journal of Operative Procedures of General Surgery(Electronic Edition), 2023, 17(02): 221-225.
[7]	Yingmin Jia, Shujiao Zhang, Yunling Geng, Zijing Cao, Yaoxian Wang, Renhe Lv, Yuning Liu, Weijing Liu. Effect of Cordyceps sobolifera mycelium combined with Haikun Shenxi capsule on autophagy-lysosome pathway of diabetic renal tubular epithelial cells [J]. Chinese Journal of Kidney Disease Investigation(Electronic Edition), 2022, 11(04): 212-218.
[8]	Xiaohong Wang, Jing Qian, Wenjun Weng, Guoxiong Zhou, Shunxing Zhu, Xiaoming Qi, Chun Liu, Ping Wang, Wei Shen, Ruizhi Cheng, Jinghao Qin. Effects of regulation of nuclear factor-κB signal by mercaptopyruvate sulfurtransferase mediated autophagy on rats with severe acute pancreatitis and its mechanism [J]. Chinese Journal of Digestion and Medical Imageology(Electronic Edition), 2023, 13(06): 422-426.
[9]	Yanhui Cen, Yue Gao, Jiang Lin, Peng Liu, Wei Jia, Rui Yang, Wei Huang, Xin Lin, Zeping Huang, Zhiying Ning. Hydrolyzed Nanzhu solution regulates the effect of autophagy on oxidative stress damage in human microvascular endothelial cells through the Wnt/β-catenin pathway [J]. Chinese Journal of Clinicians(Electronic Edition), 2023, 17(01): 72-79.
[10]	Ruye Guo, Liming Meng, Nan Chen, Yuying Song, Haiyan Yin, Yan Guo. Research status on the neuroprotective efficacy and mechanism of Apelin/APJ system in Parkinson disease model [J]. Chinese Journal of Diagnostics(Electronic Edition), 2023, 11(04): 276-282.
[11]	Minchang Li, Changlin Ma. Research progress of autophagy regulating cell ferroptosis and the effects of ferroptosis in tumors [J]. Chinese Journal of Diagnostics(Electronic Edition), 2023, 11(02): 140-144.
[12]	Tong Shen, Cheng Shen, Lijun Gan. The role of vesicles in the process of coronary artery calcification [J]. Chinese Journal of Diagnostics(Electronic Edition), 2023, 11(01): 1-4.
[13]	Bin Lyu, Liangcong Hu, Xudong Xie, Bobin Mi, Jishan Yuan, Guohui Liu. Advances in mechanism of intervertebral disc degeneration: The regulating role of melatonin [J]. Chinese Journal of Geriatrics Research(Electronic Edition), 2022, 09(04): 58-64.
[14]	Zhengda Li, Yanbin Zhang, Maoxia Liu, Xinjing Yang. Protective effect of esmolol on sepsis-induced intestinal injury and its mechanism [J]. Chinese Journal of Hygiene Rescue(Electronic Edition), 2023, 09(02): 90-95.
[15]	Tian Qiu, Miaojuan Yang, Bo Hu, Yi Guo, Yitao He. Research progress on the mechanism of mild hypothermia therapy for cerebral infarction [J]. Chinese Journal of Cerebrovascular Diseases(Electronic Edition), 2023, 17(05): 518-521.

Please choose a citation manager

Content to export